Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15045C11
Clone ID IST15045C11
Vector VICTR78
Project tigm

Sequence tag IST15045C11BBF1
Sequence
AAAGTAGCAAACCACCACTAAAGAGAACAAAAATGCAGCCAGGCATGGTGGCACACGCCTTTAATCCCAGCACTTGGGAG
GCAGAGGCAGGCGAATTTCTGAGTTCGAGGCCAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCNGGACTACACAGAGA
AATCCTGTCTGAAAAAAACAAACAAACAAACAANCAAAAAAGGGATCACTGAGGANATAANTAACCTCTGGNNNGNNGCC
TCNNGGGCGTCCNATATTTTGACNTTNNNNCCNGNTGCTGTCATCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15045C11HMR1
Sequence
NTTGAGGGATCCGTAAGCACCGCGCTGACGTGCTGTCTAGTGCTCCAGGACTGTGATGGGGCTTANAGCGACAATCGGTT
TGTTACATAAACCATTTTTCAGGTGTGGAACAACTCAGTATTATGTGGTCCTTTGGGCAGTGAGTTCAACGCTAATGAGA
ACTGTACGTTTATTAAATAANATCTCTTTAACAGAAGTACACACCANANAACATTGTATGAGTTGATGATANCGTTC
Sequence Type genomic DNA
Unitrap ID UNI4977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29852472..29852706 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024018 (1110021J02Rik) RIKEN cDNA 1110021J02 gene Gene [Source:MGI Symbol;Acc:MGI:1915847]

 
Come back to gene ENSMUSG00000024018


For any suggestions or comments, please send an email to unitrap@crg.es