Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0306
Clone ID AG0306
Vector pGT0lxr
Project sanger

Sequence tag AG0306
Sequence
GGGCGCGCGCGCTTCCCCAACCTTCTCCGGGGGCCCCCCGGAGCTGCAACCCTTCTTCTTCATTCCCTGGACGGTCGGGC
GTCCACGGGCGTGGACATGCCGGAGATCAGCCTCCGCCACGTCGTGTCCTGCAGCAGCCAGGACTCGACCCATTGTGCCG
AAAATCTTCTCAAGGCGGACACTTACCGGAAGTGGCGGGCAGCCAAGGCAGGAGAGAAGACCATCTCTGTGGTCCTACAG
Sequence Type mRNA
Unitrap ID UNI2839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25332232..25332901 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051768 (Xrcc1) NM_009532 X-ray repair complementing defective repair in Chinese hamster cells 1 Gene [Source:MGI Symbol;Acc:MGI:99137]

 
Come back to gene ENSMUSG00000051768


For any suggestions or comments, please send an email to unitrap@crg.es