Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13081D5
Clone ID IST13081D5
Vector VICTR76
Project tigm

Sequence tag IST13081D5HMF1
Sequence
GTTTCTCTGTGTAACCTTGGCTGTCCTGGAACTCACTGTGTAGACCAGGCTGGCCTT
Sequence Type genomic DNA
Unitrap ID UNI31645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 152667053..152667109 55
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066842 (Hmcn1) NP_001019891 hemicentin 1 Gene [Source:MGI (curated);Acc:Hmcn1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34912240..34912296 55
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40570971..40571027 55
NO GENE  

 
Come back to gene ENSMUSG00000066842


For any suggestions or comments, please send an email to unitrap@crg.es