Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12637G12
Clone ID IST12637G12
Vector VICTR76
Project tigm

Sequence tag IST12637G12BBF1
Sequence
AAGCCNTCCTTTAGACTTGGGAGCTGGCTCATCAGAACCCAGAGGCACGATTCGGTCAGCCCCCGTGATGCCTTAGCCAC
CAGCAGTGACTCAGCACAGGCGTGACTCAGCCCTCACTGACGCAAGACTGCCTTAATACCCATTTTATTTTCTCCTTAAT
GGTGTGCTAAACTGAGTCAGCCCCTTATCCAGAAGCTAGAGTTTACTGCATAGTTAAAAGTCATGGTTTATAATATAGAT
CCTGGGCAAACATTTACACATCTTTTTCGGTTTANATCTG
Sequence Type genomic DNA
Unitrap ID UNI35319

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 57018168..57018446 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039745 (Htatip2) NP_058561 HIV-1 tat interactive protein 2, homolog (human) Gene [Source:MGI Symbol;Acc:MGI:1859271]

 
Come back to gene ENSMUSG00000039745


For any suggestions or comments, please send an email to unitrap@crg.es