Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14974A10
Clone ID IST14974A10
Vector VICTR76
Project tigm

Sequence tag IST14974A10HMF1
Sequence
CTAGCCTGCCCTCAATGTTGTCTAGTAAGGCATAGCTGGGGCTGCACACAGCTCACTTGGGGTTTCATTTTGTTACTGAG
TGGTTTTTTACAACCTAGTGAAAGAGGCTGGGGAATGAAAAAGGTACCCTCAAGGAACCAGGTCAGAATCTTCTGCTTCC
TGCCGGAAAGCAACGGGAATAGGGGGAAAGTTACAACTCTTTCTTACTTTTTTTTTCCNTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50146407..50146631 221
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]


Sequence tag IST14974A10BBF1
Sequence
CTAGCCTGCCCTCAATGTTGTCTAGTAAGGCATAGCTGGGGCTGCACACAGCTCACTTGGGGTTTCATTTTGTTACTGAG
TGGTTTTTTACAACCTAGTGAAAGAGGCTGGGGAATGAAAAAGGTACCCTCAAGGAACCAGGTCAGAATCTTCTGCTTCC
TGCCGGAAAGCAACGGGAATAGGGGGAAAGTTACAACTCTTTCTTACTTTTTTTTTTCNTTTTTTNNANACNNTN
Sequence Type genomic DNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50146407..50146631 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]


Sequence tag IST14974A10HMR1
Sequence
CTANAAAGGGGAAATCTGGAGAAAGGGTTAAGTGCAGGTTGTGGCAAGCTACGCTGCTGCTCACCTTTCAGAACCGCTCA
AGACTCGCCTTCCCGGAAGCTGCAGATTCTTAAGGTAAGGAACCGGGATAAGGAACCTACTTCACAGGTGGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50146258..50146410 151
NO GENE  

 
Come back to gene ENSMUSG00000073207


For any suggestions or comments, please send an email to unitrap@crg.es