Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14535B11
Clone ID IST14535B11
Vector VICTR74
Project tigm

Sequence tag IST14535B11HMF1
Sequence
AGTANAGTCTTGGCTTCCAGACACCACTTAAAAGCCACCCAGCTAGCCGGGCGTGGTGGTACACACCTTTAATCCCAGCA
NAGGTTGGCAGANTTCTGANTTCNAGGTCNNCCTGGTCTACAAAGTGAGTTCCAGGACAGCTAGAGCTACACAGAAAAAC
CCAATCTCAAAAATCCNAAAAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14535B11HMR1
Sequence
ACTGAGGAGCTTCATTGACTTGAAAGGCATCTGTGAAGGACTGGCCCTCTGTGTTTGTGTTGAATGTGAGCATTTCATTC
TAGACACTATCAGCTGTTACTGACGGCTCTTCTGGCTCTGGATTACTAGTCACACCCACCTTTGTAAACTGAGACCTATA
GTCTTTGTAAGTCTGACATTAATTTTGTGTTACTTCCCTCTCCATCCTGTATAGTTGGAGTTCATGATGAGAAGTAAGGC
AAGGAGAG
Sequence Type genomic DNA
Unitrap ID UNI29490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32374899..32375146 248
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es