Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10195E5
Clone ID IST10195E5
Vector VICTR76
Project tigm

Sequence tag IST10195E5HMF1
Sequence
AATAAATAGCCTGGGCTGTATTGGTAATCCCACTACTTGGATATCACAAGGCGAGTCAGAAATTCAGAGTCATCTTCAGC
AATATAATGAGATGCAGGGTCAAACTGGGATACAAGAAAACCGGTCTCAAACGTCAGTCAAATCAAAGCTTAAAAATGAC
NAATCANCTCCTTCGAAAACGCAACCGCCAGGGAGGGCTGGGCGGTGCCAAAGTANATCTTCCGGGAGGAAGCCATCTCC
AATTGGACCACTCCCGGTGGGCGGGGCTTCTAACGGCTAGACAGGCCTGAATTGGTCANTCTGCAATANCCTCAGCCAAT
CAAGATGACNAAAGTGNCTCGCTCCANCTTGNNCAGGCGCTTTTGGGCCGCAGANGCGGGCGCTCTGCGGGTTCCTGGCT
CCGGGTGTGCTTCCGGGCTGGTGGAGGCGTGACGTCAGGGAGAGGGCANGTANGTACGGGGTGAGGACCGGTCCGCGAN
Sequence Type genomic DNA
Unitrap ID UNI22589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86794212..86794689 452
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004994 (Ccdc130) NM_026350 coiled-coil domain containing 130 Gene [Source:MGI Symbol;Acc:MGI:1914986]


Sequence tag IST10195E5BBF1
Sequence
AATAAATAGCCTGGGCTGTATTGGTAATCCCACTACTTGGATATCACAAGGCGAGTCANAAATTCAGAGTCATCTTCAGC
AATATAATGAGATGCAGGGTCAAACTGGGATACAAGAAAACCGGTCTCAAACGTCAGTCAAATCAAAGCTTAAAAATGAC
GAATCANCTCCTTCGAAAACGCAACCGCCAGGGAGGGCTGGGCGGTGCCAAAGTAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86794470..86794689 216
NO GENE  

 
Come back to gene ENSMUSG00000004994


For any suggestions or comments, please send an email to unitrap@crg.es