Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14949C9
Clone ID IST14949C9
Vector VICTR76
Project tigm

Sequence tag IST14949C9HMF2
Sequence
CCATGTTAGCCCATACGATGTTGTGTCANANAATTTTACTCAGGGCAATAGTGAAGCCGTCATGTCCCTACTTAAGCCAA
CTTCCACTTATCAATTTCCTCTGGGGGAAGGGATACAGTCTTTTTCCTCAGACACTGCCCTATGAAACACTGCCTACGGT
TCCCCACAACCTTGCTGTGCACGCCACCTGTTTCTGTTAACGCCATCAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138312903..138313109 198
NO GENE  


Sequence tag IST14949C9BBF1
Sequence
GAATCCCCTGGTGTTGTGCTAAGTCTCCATCGCAAATATGCCCCGGCAATGAAAACACAACAACACAATTAATATGAATA
CATGCTGTGCGCCTAGATTGGGCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI1957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15126597..15126705 109
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]


Sequence tag IST14949C9HMR1
Sequence
ATGGGAGCTTAATTGAGGGTAAAATATATCTCATGGTGCAATTTCCTCAACAGAATGTTGAAGAATGTTTGTTCCAAGAT
CTTTGAAAATCAAGAGGAGTTCTAATGATGACCTCAAAAGCGGTGAAGCTAAAAAAAGCAAGCCAGAAGCAGGAGGCCTT
CAGGTGGAGGGAGACAGAGATACTCCGGTCCACACATCAGTCACTGAGGAAGCTGTCACAGCANACAANCCCGGCCATGC
ATCAAGCACCANCNNTCCTTCTTGCCAGTTGGCTGAGGTTTCTTCCACAGGACCTGATGAGGGTGTGAAGGACANCCNCC
CNTCTGAANANCCTGTAAAGTCGTTTTCTAAAACCCANCGGTGGCCNGC
Sequence Type genomic DNA
Unitrap ID UNI18641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138313106..138313471 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026404 (Ddx59) NM_026500 DEAD (Asp-Glu-Ala-Asp) box polypeptide 59 Gene [Source:MGI (curated);Acc:Ddx59-001]

 
Come back to gene ENSMUSG00000026404


For any suggestions or comments, please send an email to unitrap@crg.es