Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12341D7
Clone ID IST12341D7
Vector VICTR76
Project tigm

Sequence tag IST12341D7HMF2
Sequence
GAGCTTCTATCTTTTGTTAAGACAACTTAGCAAGCTGTAGTTTCAGTAGATTCTCTTCTGGTGTCTTGGCTCCATTTATT
TCCTGTGAACATAATAAACTGTCCTAATGCAGTGTTTGGCTTTTTCCACATTTTTGTCATTTGAATTTTTTCTTCCGAGT
TTTAAAACTTTTTTTATGTTTATCTTGGCAATTTTTTTTTCCTCTAAAANCAATTTAACTTANTGCTTTAGGAAAATAGT
GATGGGACTTCAAATTAAATATTATCACATTCAATCTTTGTGAAATANTTCATGACCAAAAAGGGACTAANAAAAACATT
CCTGTATGGTATANTGANANTTTATATATTTACCACCANTTTGTCCGTGGGCAATCATCCTGATTGAAGTTGTTTTCAGG
TTTTTAGTTTCTCTGTTANCTCNCNGNTATTCTTACTGTTGANACCTTTGTGTTANNNTTNNATTTTTNAANTNGGTCNT
TNNNGAACTGCTTTNNNCTCATTTNNGTNGGAAAATATTANAGTANNAAAGCTGTNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12341D7BBF1
Sequence
ATTTCTTTATGACAGATTTCTTGGTGACACAGAAGTAAGCCAGTCCCGTACTTCCTTCTGTTCACAGGTGTACGTANCAN
CCTTCGCCATCTCCGCATATGCATCCAGCTACTTCCGAGCAGGCAGCAAGCCGTTTAACCCGGTCCTTGGAGAAACGTAC
GAATGCATCCGACAGGACAAGGGTTTCCAGTTTTTTGCCGAGCAGGTGATATGTGCTCTTTGTGTTTGTTGAGAGCATTG
CTTTGCCTGCTATTAAATGTGCTTCTGAAATATTTATTTTCCCCCTTTCACTGGCTTCAAAAGGACTGAGATAATTACAG
GCTTGGCAACATAAATCCAGGATCT
Sequence Type genomic DNA
Unitrap ID UNI32341

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 50269897..50270240 340
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029822 (Osbpl3) NM_027881 oxysterol binding protein-like 3 Gene [Source:MGI (curated);Acc:Osbpl3-001]

 
Come back to gene ENSMUSG00000029822


For any suggestions or comments, please send an email to unitrap@crg.es