Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10252C5
Clone ID IST10252C5
Vector VICTR76
Project tigm

Sequence tag IST10252C5HMF1
Sequence
CTGCTACATAGATGGGTGACCGCGTGTGCTTCATGAGGGTGTACAGATGTAANACAGCTGCATAGTACCAGGAAATAATC
CATGCCCGCCTCACATTGGGGGTGGGAAATATAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI30739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 25680927..25681045 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022272 (Myo10) NM_019472 myosin X Gene [Source:MGI (curated);Acc:Myo10-001]


Sequence tag IST10252C5BBF1
Sequence
CTGCTACATAGATGGGTGACCGCGTGTGCTTCATGAGGGTGTACAGATGTAAGACAGCTGCNTAGTACCAGGAAATAATC
CNTGCCCGCCTCACATTGGGGGTGGGAAATATAGTCAACATTTATGGCTTCTATTCTGACATGCTTAAAATTAATGAATA
AAGTTTGGCAGACCAATTACCTCACAGAGGAACCGCGCCCTANGAAGCCAGGTGCACCTGAAGCCAGGCTAATAGGACAG
GANGAGTAACTGGNNNTTTNNNAAAGTGATGACAGGGATTGGGGATTTAGCTNAGTGGTAGAGTACTTGCCTANCANGCN
TAAGGCCCTGGGTTNGGTCNTNANCTNTGGAAAAAAGAAAAAGAAGATGATGGNCTTTTCCTGCCTCGTGGTACAGGCAC
TCACAGACTTACAGACTGGCAGCTTCTTAAGTCTGCGGNCCTTCTGANTTCCTCTGACTGTAAGTGTTCTTTTCTTCTGT
CTTCCCTCTGANTGTGCGCTCGCTTCCTAATGGTTCCGCCTTCACTCTTTCCCTATAGCTCACCCCCGCCCCCNNCANGT
NGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000022272


For any suggestions or comments, please send an email to unitrap@crg.es