Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14239A2
Clone ID IST14239A2
Vector VICTR74
Project tigm

Sequence tag IST14239A2HMF1
Sequence
GTCTTCACGTCTCTTTGCCAGCGTTAGGCTGAGTTGCTGTCTCCTTCCGGGGGGAAAAAAAGACTTCCCCCAGAAATCCA
AATCTAGAAGGAAATACAGCACCACCTTTGTTTAACTATAACTACACTGTGCCGTGTTANAAATAAAATCCGAAGCGCGT
CC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17979020..17979180 159
NO GENE  


Sequence tag IST14239A2HMR1
Sequence
AAGANNNNTCTGGAGACNAAGGGAGAGATAGGAAAAAATACGTTTATAACATAGGAGGGAGGCAACTGTTAAAGCTGGGA
TCACCAAATGAAGCGCCACATGTAGCAGGCGGGAAAGGGCCGGGCCAAGGAGGTGGCGGCGGTCGGGAGGCCGGAGCTGG
GCGGCAAGCGAGAAATCCCTGGGGCCGAGGCTCCTGGGTGCTCCCATTGTTCCGCGCCGTANCCGAAGCGTGTGGCGTGT
TTTTGCCTGGGGAGGTGTGTGTGTGTGTGGATCN
Sequence Type genomic DNA
Unitrap ID UNI30716

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 17979185..17979449 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026743 (Mllt10) NM_010804 myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 Gene [Source:MGI (curated);Acc:Mllt10-001]

 
Come back to gene ENSMUSG00000026743


For any suggestions or comments, please send an email to unitrap@crg.es