Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15072H4
Clone ID IST15072H4
Vector VICTR80
Project tigm

Sequence tag IST15072H4HMR1
Sequence
TTTTTCCCCTTCCCCAGCTAGGCCCCACCCTTTGGTGATGCCACCTTTAACACAGCACCACCTGCAGGGACAGAGTGTTC
AAACACTGAACTTGTGGGAACTATTCATGTCCAAACAAACAAGCTCGTATGTGCATTGTTTGTGTGAGGTCTGGTGAGTT
CTGAGCCTTTGGTACAGCACCGTGCACAGTTCTTCCACTCTCCCATGCCTACCCTCTGTTCCTTCTCAGTCCCCATGCCC
TGAGGCAGCTGATTGCTTTTGAAACAGGCTCACCTAGCCCAGTCCTGAAGTCTGTTTTGTGGAAGATGCCTTGAACTCAC
ATCTCTACCTCCTCTGGAGTGCTGGGATGACAGTTTTGCGTTTCCACCTGTGGCATGTCCCTTTTGTTATTTAATGTTTA
TTTAATTTGATGTATGTGTGCCTGANTCTATGTCCNCACCATGTGCCTGGTGCCTTCANANCTCANAANGGGCATTGGAT
CTCCCAGANNTGGGGCCATAGATGGTTATAANCATCATGTATGTACTGGGAATGGAACCCGGGTCTTCTGCAN
Sequence Type genomic DNA
Unitrap ID UNI3327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73082405..73082956 534
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]

 
Come back to gene ENSMUSG00000070002


For any suggestions or comments, please send an email to unitrap@crg.es