Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14509H7
Clone ID IST14509H7
Vector VICTR74
Project tigm

Sequence tag IST14509H7HMR1
Sequence
CACCTGGGGCTAACAAGCGCGTTTAATCNTCATCCTGATAACAAACCTGGGAAATCAAGTGTTATTTC
Sequence Type genomic DNA
Unitrap ID UNI6241

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102878063..102878130 66
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020935 (Dcakd) NM_026551 dephospho-CoA kinase domain containing Gene [Source:MGI (curated);Acc:Dcakd-001]

 
Come back to gene ENSMUSG00000020935


For any suggestions or comments, please send an email to unitrap@crg.es