Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14704C6
Clone ID IST14704C6
Vector VICTR76
Project tigm

Sequence tag IST14704C6HMF1
Sequence
ACTAGNTGTAATTGTCTTCTTTATCTTTCTATTGCTCTGATAAAACACCATGACTAAGCCAACTTAAAAGAACAGTTTTA
GGGGGCTGGAGAGATGGCTTAGTGGTTAAGAGCACCAACTGCTCTTCCANAAGTCCTGAGTTCAATTCCCAGCAACCACA
TGGTGGCTCACAACCATCTGTAAAGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGAGATCAATGGTGTCTTCATGTTN
TATTTCANGTTATACTTCCTGTTCTGTTTAGAGGGTTAGACTCCATGATAAAGGAGCAAAGGCNGGGTACAGGAACAGCT
GANAGCNNNNNACTGGCTTTGCNNNGANAAGGTGGANAGTCTTTTGANACTTCNNGCCCACCACCCANNGANNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14704C6BBF1
Sequence
ACTAGATGTAATTGTCTTCTTTATCTTTCTATTGCTCTGATAAAACACCATGACTAAGCCAACTTAAAAGAACAGTTTTA
GGGGGCTGGAGAGATGGCTTAGTGGTTAAGAGCACCAACTGCTCTTCCAGAAGTCCTGAGTTCAATTCCCAGCAACCACA
TGGTGGCTCACAACCATCTGTAAAGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGAGATCAATGGTGTCTTCATGTTA
TATTTCAGGTTATACTTCCTGTTCTGTTTAGAGGGTTAGACTCCATGATAAAGGAGCAAAGGCAGGGTACAGGAACAGCT
GANAGCTCACAACTGGCTTTGCAAGGAGAANGTGGAGAGTCTTTTGAGACTTCAAGCCCACCACCCAGTGACATTCTTCC
TCTAACAGCGTGGCACTACCTAANTCTTCCCAANCCATTCTACCNNCTATTCNAGCGTATGAACCCTACGGGTTCCGTTC
TTTTCTANCATGGAGTATGTGACAN
Sequence Type genomic DNA
Unitrap ID UNI9591

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53756804..53757307 481
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000708 (Kat2b) NM_020005 K(lysine) acetyltransferase 2B Gene [Source:MGI Symbol;Acc:MGI:1343094]

 
Come back to gene ENSMUSG00000000708


For any suggestions or comments, please send an email to unitrap@crg.es