Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14688B6
Clone ID IST14688B6
Vector VICTR76
Project tigm

Sequence tag IST14688B6BBF1
Sequence
CAATAGCATAGTTAGGAAGTACATTATTATTAATGGGCAGCGGCCCTCAGAGCTTCCTTGGGAACTTCTATAGATGATTC
TCGGTCCCACCTCCCATGGGAATTCAGTGCCCTGGGCCTTTAGGAACCCCTCAAAGGGCAGTCTGGAAGCTGAGATCGCT
GAGGTCCAGACAGTGGCTCTTCACACGGCTGGCCTTGGAACACAGCGAGGTCTGCAGGGCAGATAAAGTATCCTCACACA
GACACTGAACAGAAAACCAAGGTCTTCAAGGAGGAAGCCGGGAAGGAAAGCAACAGGAGCCGCATGCCAACCACANGCAG
GGCTTTGCAAGGCCATTTNCCCCAGGCAACCTCTTATCCCTGTGCTANCTAGCATCANGGATGATCCTAGCNCTGAGNNC
NGAACCGTGGCTGGTGATGCTTCNNANCATGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57286357..57286788 408
 
EST/CDNA Est Name
  BB662384.1 - BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1 - AA561258.1 - AI615677.1


Sequence tag IST14688B6HMR1
Sequence
ATTGTATGTTAAAAGAACACAGTCCACCTGGGATTCTTAAAGGAGAAGCCNGCGACAGAG
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57286301..57286360 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST14688B6HMF1
Sequence
CAATAGCATAGTTAGGAAGTACATTATTATTAATGGGCAGCGGCCCTCAGAGCTTCCTTGGGAACTTCTATAGATGATTC
TCGGTCCCACCTCCCATGGGAATTCAGTGCCCTGGGCCTTTAGGAACCCCTCAAAGGGCAGTCTGGAAGCTGAGATCGCT
GAGGTCCAGACAGTGGCTCTTCACACGGCTGGCCTTGGAACACAGCGAGGTCTGCAGGGCAGATAAAGTATCCTCACACA
GACACTGAACAGAAAACCAAGGTCTTCAAGGAGGAAGCCGGGAAGGAAAGCAACAGGAGCCGCATGCNNNCNNCAGGCAG
GGCTTTGCAAGGCCATTTCCCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57286357..57286699 333
 
EST/CDNA Est Name
  BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1

 
Come back to gene BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1


For any suggestions or comments, please send an email to unitrap@crg.es