Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11231H9
Clone ID IST11231H9
Vector VICTR76
Project tigm

Sequence tag IST11231H9BBF1
Sequence
CATTATGTGAGTTAAAGGTAANAGAATACTATCCACAAGCTAACTTAAATAGAGAAATATCTATTAAAACTCTCCCCCAG
ATATCATAACATATATAGATTTTTGACTCATAGCTGCCAGTTGACATTCATGTANAGCTAATCATTAAAGATGCTAAAAC
TTAATATTTGCTTGCAAGCAAGGCATCACAATGGATTGTTTTTCATCCTGGGTGANTCNTCGGGACNAANCCNTTTTTTC
NTCNGGACNAANCCNTTTTTTTTGTTTGTTTGCTCTGTTTACATGATCCTTGGCTTTCCCTCCTTGTCNAATTTCAAAAT
GATTTAACCTGAAATGTAAAACAATANTGNANTCTGANNATNNNCNANAATTATTCATTTTTAANATGANTCTCCNGCCN
CGGGAGCNNNTGCNCCCTGTGCTGANGGGCCANGNNNGCTACNTTCATTCCTAGTANCACATTTAACTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11231H9HMF1
Sequence
CATTATGTGAGTTAAAGGTAANAGAATACTATCCACAAGCTAACTTAAATAGAGAAATATCTATTAAAACTCTCCCCCAG
ATATCATAACATATATAGATTTTTGACTCATAGCTGCCAGTTA
Sequence Type genomic DNA
Unitrap ID UNI34865

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 108005809..108005930 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035864 (Syt1) NM_009306 synaptotagmin I Gene [Source:MGI (curated);Acc:Syt1-001]

 
Come back to gene ENSMUSG00000035864


For any suggestions or comments, please send an email to unitrap@crg.es