Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11637D6
Clone ID IST11637D6
Vector VICTR76
Project tigm

Sequence tag IST11637D6HMF1
Sequence
NNACNNNNANCTAATNNNNGGCANAAATNANCTGTCTTTGAANTNNNNGAGACAAGCTGTGTNAANANGCANAANGCTNN
CNNCNNNNNGCCNNTGCCCTTTTTATCATCCCANANAATCACACTGTACACTACTCCNNATGGGATTNACCTGANGCATT
NNCAAGCCCNNATNCTGTGANTCCAATTNNNNANNNNTTCTTTTTCTTGTNNGNNAATTCCTTTCNNNCTTTACTTTTAA
TTCCAAGATCNNAGATGATTTTCACAATAAACAGCAGATTTTCCCAGAATACCTTCAGTTNAACTGNTNGGGNCACCACT
TTTTAAAAAAAATAAATTTGCGGTTCTGNNNNNTAACAGAAAAGTAACTTNNCTGANCTCNNNTGAAAACAAGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11637D6HMR1
Sequence
TGTGCTCTTTGGTTTCCTTATTTGCTGTACCTTGAANATTTCAGTGAGCTTGACACAAGCCGCATGGTGGGTAAGTAGGC
TACTTGCTAAACCTGCTGGCCTTACGAGGACAGAATGAATTACCCGAAAATTTAATCTGCCACCCAAACCCTATTTTTGG
TATTCTGATATTTTGCTTCCCAACTTTCCCATTTACAANANTTC
Sequence Type genomic DNA
Unitrap ID UNI35325

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26874078..26874281 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048249 (A930001N09Rik) NM_029870 RIKEN cDNA A930001N09 gene Gene [Source:MGI Symbol;Acc:MGI:1924378]

 
Come back to gene ENSMUSG00000048249


For any suggestions or comments, please send an email to unitrap@crg.es