Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11656A3
Clone ID IST11656A3
Vector VICTR76
Project tigm

Sequence tag IST11656A3BBF1
Sequence
GACTCTCCAGACCCAANTCAGCTGCTCCAGAGAGGCTGGGTCTGTGGTAGAGGCCATGCTGAACCTGAANAGATGGGCTG
TCTTCTACTTTGATTCCATTCAGAGCCTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI21830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35191146..35191260 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041445 (Mmrn2) NM_153127 multimerin 2 Gene [Source:MGI Symbol;Acc:MGI:2385618]


Sequence tag IST11656A3HMF1
Sequence
GACTCTCCAGACCCAAGTCAGCTGCTCCAGANAGGCTGGGTCTGTGGTANAGGCCATGCTGAACCTGAANAGATGGGCTG
TCTTCTACTTTGATTCCATTCAGAGCCTCAGATCTCATAGTTGGAGCCTGGTGTTCTCTGTCCTGACCCACCCCCATGTA
NAGTGTGATTTTATAACGTTACTCCCAGTANCAGGCTCCACCTAATGGAAGGAACACTAGGGACTATCGTAGCTGCTAGC
TCAAGGCCCANANCTGTTCANCACATANCTAGAGGACACACANCANCANAGTGGAGCCNACNCATATACTCTTGTGCCTG
TTCTCNCTCTTGANNACAGGGTTCTGGGTATAGGCAGAACCCCACAGACNANTGCTGAGCCCTCTANGCTCACGGTCAGG
GAGTCCCAAACCCAANCTGCCTGTTAGATGGGCTTTGGGCTTCCTGCGGAGACACAACACCACTCCANTACTCCTGGTTC
ANNGANNANTACTTCCTTGGGCTGTCACATTAACAGCTNNATGCNNGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000041445


For any suggestions or comments, please send an email to unitrap@crg.es