Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11751G3
Clone ID IST11751G3
Vector VICTR76
Project tigm

Sequence tag IST11751G3HMF2
Sequence
CATTGAATCTGTAGATTGCTTTTGGCAAGATAGCCATTTTTACAATGTTGGTCCTGCCAATCCATGAGCATGGGAGATCT
TTCCATCTTCTGAGATCTTCTTTAATTTCTTTCTTCAGGGACTTGAAGTTTTTATCATACAGATCTTTCACTTCCTTCGT
TAGAGTCACGCCGAGATATTTTATATTATTTGTGGCTATTGAGAAGGGTGTTGTTTCCCTAATTTCTTTCTCAGCCTGTT
TATTCTTTGTGTAGAGAAAGGCCATTGACTTGTTTGAGTTAATTTTATATCCNGCTACTTCACCGAAGCTGTTTATCAGG
TTTAGGAGTTCTCTGGTGGAATTTTTAGGGTCACTTATATATACTATCATATCATCTGCAAAAAGTGATATTTTGACTTC
CTCTTTTCCAATTTGTATCNCCTTGANCTCCTTTTGTTGTCNAATTGCTCTGGCTAATACTTCAAGTACTATGTTGAAAA
NNTANGGAGAAAGTGGGCAGCCNTGTCTAGTCCCTGANTTTANTGGGANTGCTTCCNNCTTCTCTCCATTTANNTTGATG
TTGGN
Sequence Type genomic DNA
Unitrap ID UNI1148 UNI7884 UNI32107 UNI35326

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 16426329..16426892 534
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024639 (Gnaq) NM_008139 guanine nucleotide binding protein, alpha q polypeptide Gene [Source:MGI Symbol;Acc:MGI:95776]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 29358770..29359333 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 82208927..82209490 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 66520353..66520916 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 8873990..8874553 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 6781921..6782484 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 92707887..92708450 534
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020963 (Tshr) NM_011648 thyroid stimulating hormone receptor Gene [Source:MGI Symbol;Acc:MGI:98849]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 41693584..41694147 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 22531857..22532420 534
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035919 (Bbs9) NM_181316 Bardet-Biedl syndrome 9 (human) Gene [Source:MGI Symbol;Acc:MGI:2442833]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3173058..3173621 534
 
EST/CDNA Est Name
  CA466174.1 - CN832828.1 - BU962141.1 - BU939044.1 - BU743854.1 - BE850839.1 - CF551213.1 - CN840987.1 - CF105292.1 - CA531036.1 - BI112273.1 - CB056480.1 - CB245609.1 - BB610280.1 - CN675728.1 - BB662195.1 - CA749404.1 - CA464211.1 - CF182670.1 - CX218842
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 55972299..55972862 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45050462..45051025 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 25057150..25057713 534
 
EST/CDNA Est Name
  BB645286.1 - CA584312.1 - CA584299.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 55555334..55555897 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 15574207..15574770 534
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040118 (Cacna2d1) NM_009784 calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 63950416..63950979 534
 
EST/CDNA Est Name
  BB645286.1 - CA584312.1 - CA584299.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4166242..4166805 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 13220435..13220998 534
 
EST/CDNA Est Name
  BQ891207.1 - CO431455.1 - BF465759.1 - BF463968.1 - BE956914.1 - AW125839.1 - AW825849.1 - BE980351.1 - BF462384.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 54241765..54242328 534
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 109818619..109819182 534
NO GENE  


Sequence tag IST11751G3BBF1
Sequence
CATTGAATCTGTANATTGCTTTTGGCAAGATAGCCATTTTTACAATGTTGGTCCTGCCAATCCATGAGCATGGGAGATCT
GTCNAG
Sequence Type genomic DNA
Unitrap ID UNI15225 UNI29644 UNI30807 UNI30808 UNI30809

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 3491603..3491685 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5251922..5252004 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019769 (Syne1) NM_022027 synaptic nuclear envelope 1 Gene [Source:MGI Symbol;Acc:MGI:1927152]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 7822782..7822864 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 9686003..9686085 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 4070475..4070557 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033715 (Akr1c14) NM_134072 aldo-keto reductase family 1, member C14 Gene [Source:MGI (curated);Acc:Akr1c14-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 3173058..3173140 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4365962..4366044 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16179880..16179962 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11182856..11182938 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 10877489..10877571 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 9564243..9564325 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 8107008..8107090 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 4166242..4166324 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 5637851..5637933 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049119 (1700012H17Rik) NM_173426 family with sequence similarity 110, member B Gene [Source:MGI Symbol;Acc:MGI:1916593]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3983581..3983663 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040407 (Akap9) NM_194462 A kinase (PRKA) anchor protein (yotiao) 9 Gene [Source:MGI (curated);Acc:Akap9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3766774..3766856 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5106779..5106861 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3825676..3825758 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 4767486..4767568 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_053651: 26430..26512 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166307: 51941..52023 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166335: 9323..9405 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166438: 137851..137933 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 4902681..4902763 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 2534836..2534918 79
NO GENE  

 
Come back to gene ENSMUSG00000040407


For any suggestions or comments, please send an email to unitrap@crg.es