Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14257D6
Clone ID IST14257D6
Vector VICTR74
Project tigm

Sequence tag IST14257D6HMR1
Sequence
GTTCCTCTGTTGATTTTGTTACCCTCTATCANCAGGCGTGGGAGACAAGCTCTCTTCTCTGAGTTTCAGTGGTCAGAGCA
GTCTCTGTAGGCAAGCTCTCCTCTTTCAGGGAAGGTGTACAGTTATCTGGTGTTTGGACCTCCTCCTGGCTGAAGGTGAA
GGCCCAAAACANGATCTTTCCCANAAGCTGTGTTGCTTTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI33177 UNI35327

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 20595573..20595775 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 30136678..30136880 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 37433667..37433869 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 59899569..59899771 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 11154858..11155060 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 22302568..22302770 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 83889889..83890091 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021219 (Rgs6) NP_056627 regulator of G-protein signaling 6 Gene [Source:MGI (curated);Acc:Rgs6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29231660..29231862 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3174631..3174833 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 37246673..37246875 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6724558..6724760 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 7900958..7901160 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 23016176..23016378 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13816814..13817016 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 28839708..28839910 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 9650129..9650331 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 26666642..26666844 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039335 (Spata16) NM_027583 spermatogenesis associated 16 Gene [Source:MGI (curated);Acc:Spata16-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 9985954..9986156 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 7508034..7508236 197
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 79122544..79122746 197
NO GENE  

 
Come back to gene ENSMUSG00000039335


For any suggestions or comments, please send an email to unitrap@crg.es