Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2235-NR
Clone ID PST2235-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2235-NR
Sequence
ATCAGTGAGACAAAAGACACCAGGGAATGAGTGTTGTCTAACCTCCCTGGGTTACAGGGTTACAAATTAGGGGATTACAA
ATAAAGAGGGACAGGTATAAGGTTGAGTTCACTGACCAACTTTGAAGCTGGTCTACTTGCAGCACAGAAAAGGAGGAGGA
ATAAGGTAGGTGAGGCCTTTCTGCTTTGGCAGTGGTTGACATTCACCGTGAGGAGTCAAGTAATCAATTTTACACAATCA
GTAAAAATTCCATACTGGTTCATCTTCAG
Sequence Type genomic DNA
Unitrap ID UNI15567

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 175547468..175547734 261
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078893 (BX890623.7-202) Novel KRAB box and zinc finger, C2H2 type domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2ARL5]

 
Come back to gene ENSMUSG00000078893


For any suggestions or comments, please send an email to unitrap@crg.es