Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2083-NR
Clone ID PST2083-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2083-NR
Sequence
AGAGTCCAATTGAATGTGTTTTCCAGCTACTCAGCTGCTTAAGACTTGCCCACAAGTACAGGCCAGAGACAAAGCAAGAG
AAGAAGCAAAGGCTACTGGCCCGTGCTGAGAAGAAAGCTGCTGGCAAAGGCGACGTCCCAACTAAGAGACCACCTGTCCT
CCGAGCAGGTCAGTGCTTCCCCTGCCCGTCCCCCCCACCCCCCAAAGGGAGGATGGTAAGGCCAGGCTGTGCAGTGATGT
GTGAATTTCTTCACCTGAAAATATTGTG
Sequence Type genomic DNA
Unitrap ID UNI15568

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 26767513..26767777 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062647 (Rpl7a) NM_013721 ribosomal protein L7 Gene [Source:MGI (curated);Acc:Rpl7a-001]

 
Come back to gene ENSMUSG00000062647


For any suggestions or comments, please send an email to unitrap@crg.es