Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13418C8
Clone ID IST13418C8
Vector VICTR74
Project tigm

Sequence tag IST13418C8HMF1
Sequence
ATCAGAATATCTGATTTCTTTTTGTTGTTGTTTCTTCTTTGCTCACAACTACCTAACAAACCAACCACCAACCCACCTGT
GGGCGCTAGCATTTATACAACCTCACCCTCTGGCCAG
Sequence Type genomic DNA
Unitrap ID UNI35332

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30190327..30190442 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052533 (Nup188) NM_198304 nucleoporin 188 Gene [Source:MGI (curated);Acc:Nup188-001]

 
Come back to gene ENSMUSG00000052533


For any suggestions or comments, please send an email to unitrap@crg.es