Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14157E10
Clone ID IST14157E10
Vector VICTR74
Project tigm

Sequence tag IST14157E10HMR1
Sequence
GGGAGGGTATAGGAGACTTTTGGGATAGCATTTGAAATGTAAATGAAGAAATTACCTAATAAAATTGGGGAGAAAAAAGT
TTAAATAATAAAA
Sequence Type genomic DNA
Unitrap ID UNI15165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138532682..138532774 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029729 (Zkscan1) NM_133906 zinc finger with KRAB and SCAN domains 1 Gene [Source:MGI (curated);Acc:Zkscan1-001]

 
Come back to gene ENSMUSG00000029729


For any suggestions or comments, please send an email to unitrap@crg.es