Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11652H4
Clone ID IST11652H4
Vector VICTR76
Project tigm

Sequence tag IST11652H4BBF1
Sequence
NNAGAAAGGAACCTGCCGTAAATGAGTAAGCCGGGCAGTGGGCATTTGGCAGGCGAGCAAGGGCAAAGTGCCTTGAAAGG
AAAATGAANNCCNNAAATGTTCCTTGANAAAGCAAACAGCTCAAAGGTNTGANAACCCTGTTTGGTAAACCANCNCANAN
AGGGAGAGGGTTTANCACAGGCGAGTCTATTANCCCACTACTTGTGGGCTCCTTTTTCTTCCGTGCACCCGTGTTTTGGA
AAGTTCCGGATCCG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11652H4HMR1
Sequence
TNNNTTCAAAGGGGCTTGTTCTGATTCTTGTGAGTGTATTTCTCTGCAGTTGGCTGCGTATGTTTGAAAGCAGCCTTTTA
GAGAGGACCAGCCATCTGCTTTCAGGGAAAATCTACTTTCCTCAANTCC
Sequence Type genomic DNA
Unitrap ID UNI400

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108636732..108636855 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032846 (Zswim6) NP_663431 zinc finger, SWIM domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:1914513]


Sequence tag IST11652H4HMF1
Sequence
NNANAAAGGAACCTGCCGTAAATGANTAAGCCGGGCAGTGGGCATTTGGCAGGCGAGCAAGGGCAAANTGCCTTGAAAGG
AAAATGAAAGCCNNAAATGTTCCTTGANAAAGCAAACAGCTCAAAGGTATGANAACCCTGTTTGGTAAACCAACACAGAN
AGGGAGAGGGTTTAGCACAGGCGAGTCTATTANCCCACTACTTGTGGGCTCCTTTTTCTTCCGTGCACCCGTGTTTTGGA
AAGTTCCGGATCCTGAAACACACTCCTGATTANCAACACTCGAGTTTCCAGCTGCCTTACATTTGTTCCTTTTGTCAAAG
CCCCACTTCTACCAAAGCCCTTTGTCCTGCTCAAACNCCAGCCCAGCTNACCTTACTGGAAAGGCGCTTCTGGCTTTGTC
AGCTGTGCNCATGGTAAGCAGCTGGGNNGTCTGGANAANCCATTAACTCTGGNCNGAAAACAGTGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 108636910..108637373 428
 
EST/CDNA Est Name
  AW124771.1 - AI553138.1 - AA518167.1

 
Come back to gene AW124771.1 - AI553138.1 - AA518167.1


For any suggestions or comments, please send an email to unitrap@crg.es