Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11202A2
Clone ID IST11202A2
Vector VICTR76
Project tigm

Sequence tag IST11202A2BBF1
Sequence
GGTGAATGGTGTATATATTGAAGGTTTAATGTAAACCTATCACTCANATCAAAATACGACTTGAGTTATAAGTTCAAGTT
AATTAAAAAGTCTCACATGCTGTANGAGTAAAGGACACTGGCCTCNGTCCTCCANGATTTATTGGTGGGAGGGGTGGCAT
GATGGGAGGTGAGGATCTTGACTGTATCTTCACTTCCACAGGCGATCCANGCATTGCTGGCACCCTTTTNTCACANCCNA
NTGNAAAGAATAAAAGAAAGGGANGTCAAAGCTCTCTACAAAATAATAATANATATCNATGACNATTGAAAATGANCCTA
TTTCCNNNNNANGACTCANNAATTAANATGAANCTTCCNAGGGTTCATGTCCTAACATCTAGCTCTGTGNGTGCNACCTT
ATTTGGNGAATANGAAAAAACCTGTTTTTTAAAANTCTNATCNCATTTTTTACTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11202A2HMR1
Sequence
ACCATGACNACACACACATACACACACATTGAGGTATAGCAATGCATTCCTGTAATCCAGTTCTCAGAGGATCAAGAATT
CTAGGGCAGTCGGGCAGTGGTGGCACACACCTTTAATCCTAGCACTTGGGAAGCAGAGGCAGTTGGATTTCTGAGTTCGA
GGCCAGCCTGGACTACAGAGTGAATTCCAGGATAGCCAGGGCTATACAGAGAAACCCC
Sequence Type genomic DNA
Unitrap ID UNI6550

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154326373..154326589 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038533 (Cbfa2t2) NM_172860 core-binding factor, runt domain, alpha subunit 2, translocated to, 2 (human) Gene [Source:MGI (curated);Acc:Cbfa2t2-001]

 
Come back to gene ENSMUSG00000038533


For any suggestions or comments, please send an email to unitrap@crg.es