Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2012-NR
Clone ID PST2012-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2012-NR
Sequence
TATGTACCCTCTTCAGGAGCGCTCGCTCCCAGCTCTGTGGTGGACCTAGAGGCTCCATGCTGGCTGAACCCCCCCCTTGA
TTTGAATCTTCCTGAGGTCCCTAGTCTTGTGGCTTCCCCTTCTCTAGGGCCTCAACTCCCCGGGAACACTTCCCTGCACT
GTACCTCAGCTTCTCCTTCCCCCTTCCAGAACAACTAAAGCCCCTGAAGACCTATGTGGATCCTCACACTTACGAAGACC
CCAACCAGGCTGTACTCAAGTTTACC
Sequence Type genomic DNA
Unitrap ID UNI15570

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140877193..140877456 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es