Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11188D11
Clone ID IST11188D11
Vector VICTR76
Project tigm

Sequence tag IST11188D11HMF1
Sequence
AGGTGAACTATGGGGACTAATTCTCAGGAATTAGTCAGGTCANATGTCTGGGACATTGAAGATTGTGTAAGAGTTTAAGT
GGGATGGGACACGGTGGAGGGGTTTGGGGCCTAAGAGGANAGCAAGGGGGAAA
Sequence Type genomic DNA
Unitrap ID UNI23753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30017683..30017814 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043557 (Mdga1) NM_001081160 MAM domain containing glycosylphosphatidylinositol anchor 1 Gene [Source:MGI Symbol;Acc:MGI:1922012]


Sequence tag IST11188D11HMR1
Sequence
NCTCAAAGCTGCCNAAGTATTGGCATCCCAGGGAGGCTTCCCTGTGAACCCCAGGAGTGGCAAACCCACCTTCCAGACAG
AGAAACTGAGGTTCTCCTTTGATTGACCCTATCCACTCCCCTCCTTCCTCCTCCTGCTCTTTCTCTTCCTCACAACAGAC
TCCTGAATTTTGTCCTAACCAGCCAGCTTTTGTCCGTGCCCCAGGGCCTTTGCACTGGCTGTTTCCCAAGCTGGAAGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30017813..30018050 236
NO GENE  

 
Come back to gene ENSMUSG00000043557


For any suggestions or comments, please send an email to unitrap@crg.es