Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2102-NR
Clone ID PST2102-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2102-NR
Sequence
CCCTCAGTTCTGGCCAGTTGGCCTTATGCCTTTGTCACCTCTGTCTGTGTCCTCGGGACAATCTGGCACCTACTGAAAGT
TTCTGGCACACCCTGTGTGTTTGGCTTGATTCGGTTAATAAGTAGATCTTTGCCACTTTTCTCTTTCTTGCTGGGCTCCC
TTCTGAACACCAACAACTGAAGTTCAGAGTATACAAGCTTGGTTTCTACAGAACCTTCAAATTTGACCTTCTATAGCCGG
GG
Sequence Type genomic DNA
Unitrap ID UNI10495

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 110369326..110369566 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020186 (Csrp2) NM_007792 cysteine and glycine-rich protein 2 Gene [Source:MGI Symbol;Acc:MGI:1202907]

 
Come back to gene ENSMUSG00000020186


For any suggestions or comments, please send an email to unitrap@crg.es