Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12681C7
Clone ID IST12681C7
Vector VICTR76
Project tigm

Sequence tag IST12681C7BBF1
Sequence
CCAGTTCTGGCGCCAAAATGTTGCGGCCGCCAGCAGCTCGCAACGTGAACGGTTCGACTGAGAAGGCCGCTCGAGCTGTA
AGAGAGGAATCTANACGGGGCAAGAGAAAANAATGTANCCAAGACAGTTACTCTGATCAAGGCTCANATTTTANTGNTGT
GACNCCNNTTATGAANGAAGGGGGANGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12681C7HMF2
Sequence
CCAGTTCTGGCGCCAAAATGTTGCGGCCGCCAGCAGCTCGCAACGTGAACGGTTCGACTGAGAAGGCCGCTCGAGCTGTA
AGAGAGGAATCTAGACGGGGCAAGAGAAAAGAATGTAGCCAAGACAGTTACTCTGATCAAGGCTCAAATTTTATTGTTGT
GACACCNNTTATGAANGAANGGGGANGN
Sequence Type genomic DNA
Unitrap ID UNI31094

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89638020..89638204 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060961 (Slc4a4) NP_001129732 solute carrier family 4 (anion exchanger), member 4 Gene [Source:MGI Symbol;Acc:MGI:1927555]

 
Come back to gene ENSMUSG00000060961


For any suggestions or comments, please send an email to unitrap@crg.es