Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13061F3
Clone ID IST13061F3
Vector VICTR76
Project tigm

Sequence tag IST13061F3BBF1
Sequence
NNTGNNNNTGTCCNNGCCNCANGGNNGCNNGNNGTCCNNANANAGGTCCNNTTGCNNANGCTCCNAATGCACAGACCGGT
TACCNANNNNCTGCANTGCANCNNCNCACAGTTCCTGGACCCGGCGAATCTTGGCAAAGGGCANCGTGTGGCGCCAGGCC
TGGGATACACTGAGCGCATCCCTGGATGTGGTCTTGAAGGCTTCACGGCGCGCGCCTGGCCCTGAACCATGCGTGATATT
GTGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13061F3HMR1
Sequence
CAAGTGGGCATCGTCCACGGAGAAGCAACCGGAATCTTAGAATTTTAGTGGAGAGACCCAGCTATAACATTAGGGTCTAT
TGGAGTATGATAAAGAAAGGGCTTGGAGAACCCAAAAGCAAGTAGCTGGGAGTGTGAGTGATCTTGTCCTGTACTAGGAA
AGGATGGAGTCCAAATCCCACATCTCTTTCTGTCCAGATTGTAGTTTTCGGTTGGGTCTTTTAGGATTTGGATTCCCACC
AAGTACTATCGAATGGAAAGCAAAAGCTGTGCCCACTTCCTTCANAGAGGCAGCCAGCCTCCTACTAAAGCACTTCCTTT
CTCGTTC
Sequence Type genomic DNA
Unitrap ID UNI14352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114413413..114413738 324
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031952 (Chst5) NM_019950 carbohydrate (N-acetylglucosamine 6-O) sulfotransferase 5 Gene [Source:MGI Symbol;Acc:MGI:1931825]

 
Come back to gene ENSMUSG00000031952


For any suggestions or comments, please send an email to unitrap@crg.es