Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14639H12
Clone ID IST14639H12
Vector VICTR74
Project tigm

Sequence tag IST14639H12HMR1
Sequence
CCAGAACGTACAGGGGTTCCTGGAGTGGTGGTGACACAGTGGGTTCTCGTTTCTAAACGACGCATAATGACTTTTTAAAC
TCTTTGCTCTCTCCTTCATCCCTAACCTGAAAAGAAGTGGCTGTTAAAATAAGGAAGTGGCCTTTCTTCTAAGCCTTGAG
CTGTACAGTTATCTCTCTGGCTTTGAAAATAGGCTTCATGATTTCCAGCCATTTTGTCCAAATACTTGATTATCATTTAT
CTTCCAGAGTTTGTAGGAATGCTAACGTTAANTTCATTTTCTCCAGTATTTTCTTTATTTAAAAATGTATTNNNNNCACA
CAGTTC
Sequence Type genomic DNA
Unitrap ID UNI6229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107755881..107756205 311
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]


Sequence tag IST14639H12BBF1
Sequence
TGGCAAGNNCTGTACTCTGTGGCAGGTAGCACATGANNGNCTAAGCGCGGCTTGGAGACTGAGAGCTCCCCTTTTAGACT
CTTCCCACAGCCAGGGATAAGGTCAGGGCTAATTCAGCCCCTGCTCCACAGCAAACGGGGCAGCGGACAGAGCCCTACCT
ACTTATCATCTGATTTGCTTCAAGCGTTCAAACTCACTAAGATCCAGCCAGTACTCAAAGACGTCTCAGCAAAGCCACAG
GGACAGACTTTGGCCTGCAGGCTCTCAAAGCTTTGCAACACAAAGGCTATTTTACAAACTGCACTTGTTCTAATGTCACA
GAAGACTGCAGGCTTCANAGCTGGAAGGAGAGAAGATGGTCATGGAGAGAATGGTTGTGGAGAGGAATCGGGGTGAGTTA
GGCCTACTTCCTGTCNAGTCACATGCTCTGCTANCTNNAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107755440..107755883 424
NO GENE  

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es