Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11785F9
Clone ID IST11785F9
Vector VICTR76
Project tigm

Sequence tag IST11785F9HMF1
Sequence
CATTACTGTGAAAAGCTCAGCTCACAGGCTAACATCGCGTGCTGTGACCNAAGACTTTTTTAAAAGCCCAATTTCCCTGT
GGCTGCCCACATGCTGCAGCCTGGTTCTTTCCAACTTNAGCTGCCCAGAGCTGGGCTGCATGGA
Sequence Type genomic DNA
Unitrap ID UNI26291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 67825349..67825491 139
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071281 (Zfp71-rs1) zinc finger protein 71, releated sequence Gene [Source:MGI Symbol;Acc:MGI:107769]

 
Come back to gene ENSMUSG00000071281


For any suggestions or comments, please send an email to unitrap@crg.es