Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14791D7
Clone ID IST14791D7
Vector VICTR76
Project tigm

Sequence tag IST14791D7BBF1
Sequence
ATGGCACATGCCTGTAGCCCCAGCACTCTGGAGGCAGAGGCAGAGGCAGACAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 98119940..98119997 58
NO GENE  


Sequence tag IST14791D7HMR1
Sequence
NNNCTGGAAGTTCAGGGCCTCTGCCTCAGGGTCAAAGGCCGAGCTGATAGAAGAGGCCCGAAGATGCTGCACCAGCTGGG
GCTGGAGGCCCCGGGTCTCATCATACTGGATGCTGTGATTGCAGCGCAGGGAGGCTGGGAGGCTGTCGTGGAGGAAACGC
TGTGTGGAGCCCGCAAATANCTGGCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31308936..31309118 181
NO GENE  


Sequence tag IST14791D7HMF2
Sequence
CAGCTTACCACAGCCCTGCAAACAGGTGAGGCCCCACTGTCCCACTTCCACCCTACCAGCGAAGACGGCCAGAGTCCCAA
ATTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI35339

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31309116..31309202 87
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055632 (Hmcn2) hemicentin 2 Gene [Source:MGI (curated);Acc:Hmcn2-001]

 
Come back to gene ENSMUSG00000055632


For any suggestions or comments, please send an email to unitrap@crg.es