Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST3102-NR
Clone ID PST3102-NR
Vector U3NeoSV1
Project escells

Sequence tag PST3102-NR
Sequence
ATGGGGAGATAGACGCTGCTGCCTGTGAGTCTTGGGCCCTGGCAGTTGAGGACGAAGAGCGGGAGGAGGGTGTCAGGACC
CAGACCCACAGCGGGTCAGTGCTGGAAGAACTATGGCTGTGGAAGAGACGGGGCTGAGGAGCCCAGGCTCTTGGGACGGG
ACTTGAGGGGTTCGGGCTCGCAGAAGCAGCGGCTGTTGGGGACTCGAGCTCTGAATGAGAGACTTAGGAAACGGGGACGG
ATGTGGATTCTGCAGCATCTGAGGGAAAGCCC
Sequence Type genomic DNA
Unitrap ID UNI10755

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 131830379..131830648 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028899 (Taf12) NM_025579 TAF12 RNA polymerase II, TATA box binding protein (TBP)-associated factor Gene [Source:MGI (curated);Acc:Taf12-001]

 
Come back to gene ENSMUSG00000028899


For any suggestions or comments, please send an email to unitrap@crg.es