Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12093F4
Clone ID IST12093F4
Vector VICTR76
Project tigm

Sequence tag IST12093F4HMF1
Sequence
CAACTAGCCTGACTGGTCCAGGAATCCTCATGTTGTTGCACACCCAGTGTGGGACCGTGAAAAGCAGCCTGTTTTGGTTG
AACGAGGCTTGCTCTTGGAGACCAAGTAGAAAACTCTACAAGGGACAGAACAGTGAGCCACATTCCCAGAGACAGGTGCC
TGACACCACAGATCCCCCAACTCCATAATTCTGTGACTATCAGTCACATAGACAAAGCCCCAAGCTCCTAGCACTCTGGC
TAGACACCACCCCCACAGTTACTTGAAAATAGCTAGGTATGCTCCTCCCCACAGTTACCTGGCAACAACAAGGTANCCCA
CTATAAAAGGGGCTCCTTGGCCCCACCTCTCTCTCTTCANCTCTCACCTTTCTTAATCTCATCTCTAGCTCTCCTTTTGC
TTCCTCCCATCCCCCTTCTNTACACATGGA
Sequence Type genomic DNA
Unitrap ID UNI31050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 57170828..57171256 423
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022366 (BC026439) NM_172378 BC026439 proteinPutative uncharacterized proteincDNA sequence BC026439 ;; [Source:UniProtKB/TrEMBL;Acc:Q8R0S9]


Sequence tag IST12093F4BBF1
Sequence
CAACTAGCCTGACTGGTCCAGGAATCCTCATGTTGTTGCACACCCAGTGTGGGACCGTGAAAAGCAGCCTGTTTTGGTTG
AACGAGGCTTGCTCTTGGAGACCAAGTAGAAAACTCTACAAGGGACAGAACAGTGAGCCACATTCCCAGAGACAGGTGCC
TGACACCACAGATCCCCCAACTCCATAATTCTGTGACTATCAGTCACATAGACAAAGCCCCAAGCTCCTAGCACTCTGGC
TAGACACCACCCCCACAGTTACTTGAAAATAGCTAGGTATGCTCCTCCCCACAGTTACCTGGCAACAACAAGGTAGCCCA
CTATAAAAGGGGCTCCTTGGCCCCACCTNTCTCTCTTCAGCTCTCACCTTTCTTAATCTCATCTCTAGCTCTCCTTTTGC
TTCCTCCCATCNNCCTTCTCTACACATGGCNNTGGCCGGCCCCTCTCTTTNTTTTATCTTCCCTCNNNNTCTTTGCCCTT
CTACAATAAAGCTCTAN
Sequence Type genomic DNA
Unitrap ID UNI31050

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 57170761..57171256 476
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022366 (BC026439) NM_172378 BC026439 proteinPutative uncharacterized proteincDNA sequence BC026439 ;; [Source:UniProtKB/TrEMBL;Acc:Q8R0S9]

 
Come back to gene ENSMUSG00000022366


For any suggestions or comments, please send an email to unitrap@crg.es