Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0443
Clone ID GC0443
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0443
Sequence
CTTGGTGAGGCTCAAGGGAGGACACTTCCACTTCTGTGTATTCTACATCCATGTTCTGGGGGTCTTAATGGCTGTTGGCT
TCCACACTAGGCTCATAAATCTTCTCGCTGTTGTAGTTCAAAAGTGGAGCAGCTGGCCTGCTACATCTCAACGGCCCTCT
CCCTGTTGGAGTTCAGAAGTGGAGCAGCTGGCCTTCACATGTAAATGAAGAAGAAAAGAGAAAATTAG
Sequence Type mRNA
Unitrap ID UNI272

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106540863..106544280 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es