Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11606C8
Clone ID IST11606C8
Vector VICTR76
Project tigm

Sequence tag IST11606C8BBF1
Sequence
ATCTGTACACAGGCTCTTGGTACTATCTACAGCGATCACATGTTTTATTTTGAATATTTTGGGTCAAATTCTTGGAATAA
AATACCTTGTAATCTAGTGATACAAAAGACAGAATCTTTTCTCCTGCCCATTCCATTTCATATGCTTCTTTCTGAAAACC
CCAAGATCCAAGGAGTGACACTTCTGTGCCTGTCCCTTNTNAGTCCTGTNNGGAGTGGCANTGTGAGCTGCCTCCAGGAC
CTTANATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107757722..107757970 237
NO GENE  


Sequence tag IST11606C8HMR1
Sequence
TATCTTCCAAGTTGGATTCTGAGACTTTTCAAGTGACATTTACTACTAGTAGACTTCTCTGCTAGTTTAATGGCAGTAAA
CTACTAAGGTGGATATCACTCTGGGGCCTGTTCACTCACTAATTCTGTTTATTCTTCCCTTGTATTTGTACTAAAGTCTG
AAAGGGAAAGGCTCTTTCCAGCCAATATTATAAAGCAGGAGCTGTGGGCCAGAAGCGAGAGACATGGCNTTCNTCCNCCA
NTTTTGTTTTTAAGCTTCCAAACTTGGTTAGTTGGGGGAAAGGACTGCCTTACATATTCCCTGTGTGTTGGTGCTTTGTT
GTAANGCTGTANCTGCTGGTAAATAAATCNNTTGTTCNNAGTGTGTTTNATTTTTGTTTTGTAGTCNCCTCTN
Sequence Type genomic DNA
Unitrap ID UNI6229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 107757998..107758389 368
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031889 (D230025D16Rik) NM_145604 RIKEN cDNA D230025D16 gene Gene [Source:MGI Symbol;Acc:MGI:2443049]

 
Come back to gene ENSMUSG00000031889


For any suggestions or comments, please send an email to unitrap@crg.es