Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2646-NR
Clone ID PST2646-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2646-NR
Sequence
GAGTGTGGGTCTCAAGAACCCACATAAATACTGAGTGAGTGTGATGGCCCTCCTGTAATTCCAGTATTCCTCAAAAAACA
GACAGGGGCTTCCCAGGGCAAGCTGGCTAGCTAGACCAGCCATGTCCACATTCAGCCTCCATGAATATGGTGAAGAACTG
TTGTTTGTATTGATACTAGATTTTTTTTTCCATACACTATATTCAGTTTTGTTTTGTTTTGGAAACAGGGTTTCTCTGTA
TAGCCCTGGCTGTCCTG
Sequence Type genomic DNA
Unitrap ID UNI272

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106538109..106538365 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es