Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12095E5
Clone ID IST12095E5
Vector VICTR76
Project tigm

Sequence tag IST12095E5HMF1
Sequence
CCATAATCCCGGCACTCAGGGTTGCTGTGAGTTTCAGGCCNNCCTGAGCAGCAAACAAACAAAAAAGAAAAAGAAAGGAA
ATATTTGAGAGGAAGGGATCAAAGGAAGTGAGAGAGAAAACATAAGAACGATTCTATTCTTATTTTTATATTTAATAAAG
AGCTGTGATAAACATCTGTACAATCAATGCACAGAGTTAGGCCTCACTTCCTTGTGGACCAACTATCCATACATTAAATA
TTTGTTTAGCATTCCTAGTGTTAGGCACCGTGCCCAGCCCTAGGAAAGACAGATGGAAAGAGAACTGTCCTAGGGGAACC
GTCCTATCTCGCAAGGGGACACAANCAATAGTCCTCTCATGAGATAACAATCCANCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117086582..117086961 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]


Sequence tag IST12095E5BBF1
Sequence
CCATAATCCCGGCACTCAGGGTTGCTGTGAGTTTCAGGCCAGCCTGAGCAGCAAACAAACAAAAAAGAAAAAGAAAGGAA
ATATTTGAGAGGAAGGGATCAAAGGAAGTGAGAGAGAAAACATAAGAACGATTCTATTCTTATTTTTATATTTAATAAAG
AGCTGTGATAAACATCTGTACAATCAATGCACAGAGTTAGGCCTCACTTCCTTGTGGACCAACTATCCATACATTAAATA
TTTGTTTAGCATTCCTAGTGTTAGGCACCGTGCCCAGCCCTAGGAAAGACAGATGGAAAGAGAACTGTCCTAGGGGAANC
GTCCTATCTCGCANGGGGACACAAGCAATAGTCCTCTCATGAGATAACAATCCAGCCTGGCCACAAAACAGTCCAATGTT
CATCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30557

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 117086552..117086961 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028677 (Rnf220) NM_025739 ring finger protein 220 Gene [Source:MGI Symbol;Acc:MGI:1913993]

 
Come back to gene ENSMUSG00000028677


For any suggestions or comments, please send an email to unitrap@crg.es