Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2522-NR
Clone ID PST2522-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2522-NR
Sequence
GCCCCTCTTGAAAAGAGGTAGTCATGGCTGTCAGATAGGGGTTGGTACACCACCTCCCTCCCATTTTCCCCAGTTTCTGG
GTTTCCTGCGCGTGTCCTTGAAGTCCAGGTGGGTTCCTGGGAGTTGTCAGCCTTGCATTTGGAGCTGTTCAACGCTTGTG
CATG
Sequence Type genomic DNA
Unitrap ID UNI10011

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 35583730..35583893 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018846 (Pank3) NM_145962 pantothenate kinase 3 Gene [Source:MGI (curated);Acc:Pank3-001]

 
Come back to gene ENSMUSG00000018846


For any suggestions or comments, please send an email to unitrap@crg.es