Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2436-NR
Clone ID PST2436-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2436-NR
Sequence
TTTCCTGATGAAGCTGCAAGCTTTATTCGGGTCAAGATTATAAGGCTCAGTGCCTTGTGGGAAAAAATACCAATATTTGC
CCTTAAAAGCATTTCACTACACAGTGGAGAATGTAGAAATTGATTATTTACGTTCCCTAGTTGGTGTTTGAGGTAACAAG
GTCCCAAGTTTAAAAAGAGGAGGGAGCATTAAGTTTAAGGTGAATTTTAAGCTTGAAATTAGTAAATTTTGTGCTATGCA
T
Sequence Type genomic DNA
Unitrap ID UNI14741

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 23109722..23109960 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022884 (Eif4a2) NM_013506 eukaryotic translation initiation factor 4B Gene [Source:MGI (curated);Acc:Eif4a2-002]

 
Come back to gene ENSMUSG00000022884


For any suggestions or comments, please send an email to unitrap@crg.es