Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12520F8
Clone ID IST12520F8
Vector VICTR76
Project tigm

Sequence tag IST12520F8BBF1
Sequence
TTGTGTTAAGGTCAGAGGTCAACCTCNNNNGNNATCCCTTAGGCTCCATGTACTTTGTTATTGAGAGAGGCTCCCTCACT
GGCCTCAGGTTCAGTGATTAGGCTGGGCTGGCTGCTGTGTGCACTCGAGGGAGCCTCCTGCTTCTGCCTGCCCAGTAGTG
GAGCTATAAACACACGCACAATGCCTGGCTTTCTACACGGGTCCTAGGGATCTAACTCGGATTCTCACGCTTACACAGCA
GGCACCCCACAGACTGAAAAGACAACTCCCTGACTAGGAAAAACTTTCTGCAAGTTACATGTCTGACAAAGTATTTATGT
CTAGAATACAATTCTTTAAATGCTCAAAATTCAATGACTGCATTATAGCTCTCAAAATTCGATTTAAAAATGAACAAGAG
ATTTGAAAATGTGCTTCCCCAAACATGATACACATGTCATATGTGAGCATGTGAAATTATGCTCAAAATTCCTTANTNNT
TGGGAGAANCCCACAATAANTTACNATTACACACCTACTGGNNTATCTGAAATGAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI9646

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168051217..168051758 514
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026564 (Dusp27) NM_001033344 dual specificity phosphatase 27 (putative) Gene [Source:MGI Symbol;Acc:MGI:2685055]

 
Come back to gene ENSMUSG00000026564


For any suggestions or comments, please send an email to unitrap@crg.es