Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2378-NR
Clone ID PST2378-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2378-NR
Sequence
GTATCTAATTTCTTTCTTTCTGTTTCTTTGAGCAGGACTACTAGTAGAACAAACCAACCTCCCTAAATTACCAATAACCA
TGCACACCACCTCTTGGGGCCCTAGCATTTATATACCTTCTGAAAAGTGTCTTGAGTTGCAAATGTCACACAATTACAAA
GACTATCTGCAGCTGGCAAAACCAAGCCTCTGCTAGAGGGTGATGCAAATCATAAAGAGCTACTGTGGACAGTTGGAAGC
ACCCCATCTCCCCACACCTGGG
Sequence Type genomic DNA
Unitrap ID UNI4992

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95065603..95065864 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es