Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2364-NR
Clone ID PST2364-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2364-NR
Sequence
GAAGAGGCAGGGTCGTTGCAGAAGAGCTAGTCTTGGCCAGTTCTGCACAGGAACTGCTTCACTCGAAGAACCATTCATTA
TAGAGGCTTACTCCATTGACAGTAGTCCAGACTGCTATCTCTGCACATCCTGTTGGAGCACCTCTGGAGGGTGGTGGAAG
GGTCATGTGGCAGTCCCTGCATG
Sequence Type genomic DNA
Unitrap ID UNI10054

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4933561..4933743 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022517 (Mgrn1) NP_083933 mahogunin, ring finger 1 Gene [Source:MGI Symbol;Acc:MGI:2447670]

 
Come back to gene ENSMUSG00000022517


For any suggestions or comments, please send an email to unitrap@crg.es