Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2326-NR
Clone ID PST2326-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2326-NR
Sequence
ACGCTTACTAAGTCACTGAGCTTTTCTGGGGTGGGGGTGGGGCACTAGGTTCCATCTTCATGTATTCAGTCTCTTCCCAT
CACTCTTCTACCCAAAATTGTGAGCACTGTCTACTTTAAAGATTTTCTTCTCCTTGTACAGGGGACCCTCACAATGATCC
CAATGCTCAGGGCGATGCCTTCAAGACTCTGTTCGTGGCTAGAGTGGTGAGTACTCAGTTCCTGTCCTGAGTGGTTCAAG
GGCTTTAGAAC
Sequence Type genomic DNA
Unitrap ID UNI15577

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52642714..52642964 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063511 (Snrp70) NM_009224 U1 small nuclear ribonucleoprotein polypeptide A Gene [Source:MGI Symbol;Acc:MGI:98341]

 
Come back to gene ENSMUSG00000063511


For any suggestions or comments, please send an email to unitrap@crg.es