Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10434F3
Clone ID IST10434F3
Vector VICTR76
Project tigm

Sequence tag IST10434F3BBF1
Sequence
TTATTTCGAGACCGCCTTGTCCCGCCCTGGCCTCCGGGAACCCCGATTCATCTCTGTCGGCTACNTGGACGACACGCAGT
TCGTGCGCTTCGACGGCGACGCGGAGAATCCGAGGTATGAGCCGCGGGCTCCATGGATGGAGCACGAGGGGCGGGAGTAT
TGGGAGCGGGAGACACAGATCGCCAAGCGCAATGAGCAGAGTTTCCGAGGGAGCCTGAGGACCGCGCANCGCTACTACAA
CCN
Sequence Type genomic DNA
Unitrap ID UNI33820

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36282345..36282585 237
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073403 (CT030728.6-202)  

 
Come back to gene ENSMUSG00000073403


For any suggestions or comments, please send an email to unitrap@crg.es