Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST2295-NR
Clone ID PST2295-NR
Vector U3NeoSV1
Project escells

Sequence tag PST2295-NR
Sequence
CTGGGGTTAGCTTTCTTTTCAGAATTAGGTTTTGTGTTTCTGTTTTTATTTAGGCTGTAATTTGGAGAATGAATTTACAC
TTTCAGATTCTCCTGTTTCTACTTTCCCAAAGCTGGGCTTCAGGCTTGTTTACCACACCCAGTGTTATTCTGTGGTGAGG
GTTGAACCCATTGCTTGCTTGGTGCTTTGTAGACATCCTAGCATTGTATTAAACAAACTTCATTTTCAGCATCTCTAAAT
GTTTTACTTAAAAAGATGTATT
Sequence Type genomic DNA
Unitrap ID UNI6295

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 155327283..155327544 262
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042699 (Dhx9) NP_031868 DEAH (Asp-Glu-Ala-His) box polypeptide 9 Gene [Source:MGI Symbol;Acc:MGI:108177]

 
Come back to gene ENSMUSG00000042699


For any suggestions or comments, please send an email to unitrap@crg.es