Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14589C6
Clone ID IST14589C6
Vector VICTR74
Project tigm

Sequence tag IST14589C6HMR1
Sequence
NCTGTCNTAAAACTTCTATACTAAATTTGAGCTGCCTTTTTAAAGATGTCACTTCTGAGCTGTTCTTTATTCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI15084

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12361863..12361937 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020173 (Cobl) NM_172496 cordon-bleu Gene [Source:MGI (curated);Acc:Cobl-003]


Sequence tag IST14589C6HMF1
Sequence
AGATAATCCTTATTTTCGCATTATTAAGGATGGATCTAGAGACTCTTAAATACTTTAGCCAAAAGCAAATGTAATATGTA
GCCACTATTTCTTTAATATGAAAACACTTATGGTTTAGTACAAACAGGAGTGTATGGCTGCTCATACTGGACGCCAACAG
AAATAGGCCCTCTGTCTTGATACTGTGTTCTAAAATATTTCACTAGCTATCACTTCTGACTAGGTGAAACTGACTAGTGA
CAGGTGAGACTAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12361936..12362190 255
 
EST/CDNA Est Name
  BY021325.1


Sequence tag IST14589C6BBF1
Sequence
AGATAATCCTTATTTTCGCATTATTAAGGATGGATCTAGAGACTCTTAAATACTTTAGCCAAAAGCAAATGTAATATGTA
GCCACTATTTCTTTAATATGAAAACACTTATGGTTTAGTACAAACAGGAGTGTATGGCTGCTCATACTGGACGCCAACAG
AAATAGGCCCTCTGTCTTGATACTGTGTTCTAAAATATTTCACTAGCTATCACTTCTGACTAGGTGAAACTGACTAGTGA
CAGGTGAGACTAGTCAACAGGTAAAATCACTTCCTACACTAGCCAGCCAGCCAACCTGAGGTCAGTCCCTGTGAGAGGAG
AGAATTGACCCCCAGGCTTCCCTCTAATTTNNACTAAGGCATCACANAATGTGTGCAGTCNCATTNNNACACACNCACAC
ACACACACACACNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 12361936..12362350 397
 
EST/CDNA Est Name
  AA596970.1 - CJ166430.1 - CJ168062.1 - BY021325.1 - CJ181280.1 - CJ185221.1 - CJ112536.1 - CJ185217.1 - CJ186320.1 - CJ109498.1 - CJ108296.1 - CJ111103.1 - CJ115742.1 - CJ108083.1 - CJ127225.1 - CJ110048.1

 
Come back to gene AA596970.1 - CJ166430.1 - CJ168062.1 - BY021325.1 - CJ181280.1 - CJ185221.1 - CJ112536.1 - CJ185217.1 - CJ186320.1 - CJ109498.1 - CJ108296.1 - CJ111103.1 - CJ115742.1 - CJ108083.1 - CJ127225.1 - CJ110048.1


For any suggestions or comments, please send an email to unitrap@crg.es