Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14897B5
Clone ID IST14897B5
Vector VICTR76
Project tigm

Sequence tag IST14897B5HMF1
Sequence
GCTTTGGCAGTTCCCAGGTGGTACAGACTCTCACCTAAGCAGACTAAATTCCTAAGTTCCTTGGAGTCCCGGGACCAAGA
TGGCGACCGCTGCTGCTGTGGCTTAGGCCGCCTCCCCAGCCGGGTGGGCACCTGTCCTCCGGTCCGGAAGGTGGCCGGCT
GTCCCCGGCCCACACAGGGTGCTGCCTCANCGCCTCNGNGCTTCTGCCTGTTCCANAAGCTGTCNNGTTCTCTGGCNCAN
CNTNTN
Sequence Type genomic DNA
Unitrap ID UNI30734 UNI30806 UNI30807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 51188930..51189168 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 17705647..17705885 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11692330..11692568 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 19145713..19145951 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 4369857..4370095 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049148 (Plcxd3) NM_177355 phosphatidylinositol-specific phospholipase C, X domain containing 3 Gene [Source:MGI (curated);Acc:Plcxd3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 14305992..14306230 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 22363494..22363732 225
 
EST/CDNA Est Name
  BY302409.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 23740690..23740928 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 51378637..51378875 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 25142443..25142681 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12723168..12723406 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5270893..5271131 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 18535655..18535893 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 5110674..5110912 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 16261454..16261692 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 14606297..14606535 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 29770996..29771234 225
 
EST/CDNA Est Name
  AA286169.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 6149383..6149621 225
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068270 (Shroom4) NM_001040459 shroom family member 4 Gene [Source:MGI (curated);Acc:Shroom4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 16970181..16970419 225
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 15253902..15254140 225
NO GENE  


Sequence tag IST14897B5HMR1
Sequence
AAGCAACACACTGTCTGAGAAAGGTCCTGTTTTGGGCCTTCTTCTTCGGCCNGGAGGAGGTCCAAATACAANATATCTGC
GCACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCTCTGANCACTGAAACTCANAGGAGAGAATCTGTCTCCCANGT
CTGCTGATANACGGTAACANANTCNCCNNAANANCNNTCTNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000068270


For any suggestions or comments, please send an email to unitrap@crg.es